“UN VIAJE ES COMO UN LIBRO, SE COMIENZA CON INQUIETUD Y SE TERMINA CON MELANCOLÍA”           "VIAJAR NO ES LLEGAR A UN LUGAR, ES ABRIR UN CAMINO"           "NO VIAJES PARA ESCAPAR DE LA VIDA. VIAJA PARA QUE LA VIDA NO SE TE ESCAPE"           “COMO TODOS LOS GRANDES VIAJEROS, HE VISTO MÁS DE LO QUE PUEDO RECORDAR, Y RECUERDO MÁS QUE LO QUE HE VISTO”


12 noviembre 2011

VARANASI PARA NO OLVIDAR


JUEVES 24 NOVIEMBRE DEL 2011
Nos levantamos a las 6 con un poco de pereza para dar el paseo matinal en barca. 

Bajamos a recepción y ya nos estaban esperando. Íbamos solo con otra pareja de australianos, así que mejor porque la barca no iría tan petada.

Bajamos hasta el ghat y empezamos un paseo indescriptible por el río Ganges, todavía con las legañas pegadas a los ojos jeje.


El ganges nace en el Himalaya y desemboca en el golfo de Bengala. Es un río sagrado para los hinduistas, que lo adoran como la diosa Ganga del hinduismo. Según la mitología, el dios Brahmá creó el río Ganges a partir del sudor que recogió del pie del dios Vishnú. Años más tarde, el rey Sagar tuvo 60 000 hijos. Un día, el rey realizaba un ritual con un caballo. El dios Indra, robó el caballo y Sagar envió a todos sus hijos para encontrar al animal. Lo encontraron al lado de un sabio, pero al creer que éste lo había robado, le insultaron y golpearon. El sabio abrió los ojos y su mirada hizo arder hasta la muerte a los 60 000 hijos del rey.
Las almas de los hijos de Sagar vagaron como fantasmas hasta que terminara por completo el ritual que su padre había iniciado. Entonces Brahmá tras la insistencia de las plegarias de Bhagirathi (un familiar de Sagar) permitió a la diosa Ganga descender desde el Cielo. El descenso de la diosa Ganga a la tierra en forma de río está narrado en el Ramayana y otros textos. La leyenda dice que la Diosa Ganga bajaría a la tierra para tocar con sus aguas las cenizas de los 60.000 hijos difuntos de Sagara, para que así ellos pudieran ascender al cielo. La Diosa descendería como una gran cascada al ser un río celestial y la fuerza con la que caería en la tierra podría traer catástrofes. Shiva amortiguó la caída con su cabello haciendo fluir el torrente de agua desde las montañas del Himalaya y de esta manera serían bendecidos cada unos de los hijos de Sagar y hoy en día cada una de las personas que se bañan en el Ganges. 
Por otro lado, la polución del río Ganges se ha incrementado de forma alarmante en los últimos años. Los productos que lo contaminan incluyen restos de las cremaciones humanas, esqueletos de animales, aguas residuales y desperdicios de las fábricas. Por hacerse una idea, un río de Europa contiene 500 bacterias filiformes por litro, las aguas de este río tienen 500.000. Además hay que añadir el calentamiento global del planeta. Por todo ello se calcula que de no tomarse medidas inmediatas el río estará biológicamente muerto muy pronto.”


Nada más salir ya se notaba muchísima vida en el río, y eso que aún no había salido el sol.


Empezando el recorrido por el Ganges.

Al empezar, como estábamos al lado pasamos por el crematorio principal, el Manikarnika Ghat. 
Como impresiona verlo desde la parte del río con maderas apiladas, restos de fuego y madera, muchísima basura, restos de lo que parecía ropa, animales paseando a sus anchas alrededor de los restos …
De este crematorio dicen que el fuego lleva encendido 3000 años, cuidando siempre de que no se apague la llama de Shiva. Esta labor la realizan los llamados “doms”, una casta que según cuenta la leyenda, Shiva castigó por apropiarse de un arete de su esposa Sati, degradándoles desde la casta de brahmán a doms. Desde ese momento son estos los que se encargan del crematorio y de mantener vivo el fuego de Shiva. 
Los doms serán la casta más baja, pero con el fervor que hay por incinerarse aquí y lo que tienen que pagar, deben de estar montados en el dólar. Incluso el barquero nos dijo que el hombre más rico de Varanasi era uno de esta casta.

Por supuesto no esta permitido hacer fotos cuando pasas cerca, pero los zooms de las cámara hacen milagros.


Crematorio principal - Manikarnika Ghat

Luego empezamos a ver la vida en el Ganges, con un montón de gente bañándose, lavándose los dientes, rezando, realizando ofrendas. Todo un espectáculo.
Al parecer los hindús practicantes tiene que seguir este rito cada mañana: pronunciar el mantra sagrado, sumergirse completamente 3 veces seguidas y beber un sorbo de
agua del Ganges con la mano. (Qué valor Chocado ) Según su leyenda con cada ablución en el río, sirve para purificar un pecado; además también suelen rezar a Surya, dios del sol.



Abluciones en el Ganges

Lo curioso es que mientras íbamos pasando, muchos de esas personas saludaban sin parar (la verdad que totalmente tolerantes porque bien de fotos que les tienen que hacer al día); parecía que lo que hacían era el mejor momento que tenían del día. Se veía a la gente feliz y contenta.

Fíjense en el hombre con una ofrenda en la mano


Fíjense en la mujer rezando

De repente comenzó a salir el sol, haciendo la estampa más autentica.


Barcas con la puesta de sol

Seguimos río arriba por los diferentes Ghats e íbamos viendo cosas bastante curiosas como la de una barca con televisión incluida (la caja tonta es lo que tiene jeje).
También se acercaban barcas vendedoras ambulantes para vendernos refrescos, agua, flores para ofrendas…

 
Barca interactiva. Barca vendedoras ambulantes

Al pasar cerca del Dasaswamedh ghat vimos como algunos sacerdotes que ayer estaban representando la ceremonia del aarti estaban dando ofrendas al río con las lámparas que vimos ayer (placa de Aarti)


Puja en el río Ganges

Seguimos, y a veces nos acercábamos tanto a las personas que se estaban bañando y chapoteando que, de vez en cuando saltaba un poco de agua a la barca. Cada vez que pasaba esto las caras de los 4 era de poema, pero el barquero se medio reía.


Abluciones en el Ganges

La verdad que me picaba la curiosidad y tenía ganas de meter un poquillo los dedos en el agua, pero de repente vemos al cadáver de una vaca pasar y…. por supuesto la idea se me fue de la cabeza (en que estaría yo pensando, debió ser la falta de sueño)
De repente veo algo que alucino… un turista con los pies descalzos metido hasta los tobillos para hacer fotos.GUUUUUUAAAAAAAUUUUUUU, eso si que es valor. Aunque no fue el único que lo hacía porque empezamos a ver a varios turistas a lo largo de los Ghats haciendo lo mismo.


Un turista con sus pies en el Ganges.

Aunque claro, ahora que pienso, si algunos indios se meten en esa agua contaminada, beben, se lavan los dientes y 23478 cosas más, y salen como nuevos, pues… 


EVIDENTEMENTE EL AGUA TIENE ALGO DE SAGRADO




¿Se meterían en este agua? La verdad, que es para pensarselo

Otra cosa que se veía era a muchísima gente meditando ó haciendo yoga, tanto extranjeros como hindús. Estaban por todos lados: en la orilla, en las escaleras, en los balcones de las guesthouse…


Diferentes personas meditando

Luego nos empezamos a acercar al otro crematorio de Varanasi, en el Harishchandra Ghat. Por lo que le entendí al barquero, este crematorio es eléctrico, y es donde se incineran a los más pobres, ya que sus familias no disponen de dinero para comprar bastante madera para incinerar el cuerpo. Aunque había restos de madera y todo lo que habíamos visto en el primer crematorio.


Crematorio de Harishchandra

Continuamos y vimos algo que me llamó la atención… un partido de badminton.


Jugando al badminton

Seguimos río arriba y ya se veía menos gente, aunque seguíamos viendo grupos de personas con su ritual de abluciones.


Las abluciones a lo largo de los ghats

También vimos a muchísima gente lavando la ropa de la manera antigua, o sea: frotar, golpear, estrujar y dejar al sol.

 
Lavando la ropa con tecnología antigua

La verdad que el paseo estaba resultando bastante llamativo, además muchos de esos Ghats tienen en primera fila antiguos palacios; y en algunos los pequeños detalles de decoración eran bastante curiosos.

Volvimos a sorprendernos al pasar por un ghat con una enorme iconografía de la esvástica que usaban los nazis. Al principio me chocó, pero recordé que había leído en algún lado que ese símbolo fue apropiado por ellos, ya que es un símbolo bastante antiguo y presente en muchas religiones. Para el hinduismo representa al dios Surya (dios sol) y es símbolo de buena suerte. 

 
Detalle curioso de uno de los palacios. Ghat con el icono de la esvástica.

Luego llegamos a un punto en el que el barquero dejo de remar, y nos dejamos llevar por la corriente hasta el comienzo.

Nos empezamos a acercar a la otra orilla, en el que había una especie de playa, y como en el lado de los Ghats, había gente haciendo sus abluciones, meditando… El barquero nos dijo que esa parte era menos profunda y que la gente que tenía un poco de miedo al agua, iba a esa zona para hacer el ritual.


Lado menos profundo que parece una playa

Al estar más lejos de los Ghats, se podía ver una panorámica impresionante de los diversos escalones, en donde se veía en un conjunto que cada ghat tenía su propia estructura, forma y color.


Panorámica del Ganges en Varanasi. Fíjense la estructura y colores de los diferentes ghats

Por fin llegamos otra vez al crematorio principal, pero esta vez había algo curioso, ya que… en las escaleras del ghat había un cadáver tapado por un sudario anaranjado, supongo que a la espera para el ritual de la cremación.


Vista del crematorio, con cuerpos a la espera de ser incinerados

La verdad que Varanasi tiene un espíritu contradictorio, hacía unos momentos veíamos los Ghats llenos de vida y… ahora vemos la muerte. Sin duda, vida y muerte unidas en Varanasi.

Con más pena que gloria se terminó el paseo tras 2 intensas horas observando cosas que en mi vida había visto. Además creó que aunque te lo expliquen es muy difícil hacer entender lo que realmente tiene esta ciudad. INCREIBLE



Finalizando el paseo

Ahora toca desayunar que nuestros estómagos ya están hablando solos. Así que nos fuimos a nuestras guesthouse a tomar un enooooorme desayuno.

Desayunamos de una manera que parecía que no habíamos comido nada en 2 días (comer tanto vegetal es lo que tiene). 
Nos comimos: banana lassi, 4 tostadas, huevo revuelto, pancake de champiñones, cebollas y tomates (buenísimo), agua por 245rp.

Tras el desayuno una duchita y dejamos las mochilas en la guesthouse hasta la tarde para seguir explorando esta alucinante ciudad.

Cerca de nuestra guesthouse vimos el llamado pozo de Manikarnika “donde se dice que a Parvati se le cayó un pendiente y Shiva cavó un hoyo para recuperarlo”. Es como una especie de estanque en donde hay un montón de desperdicios, ropa, basura… Lo curioso que había bastante gente en el interior, supongo que buscando algo de valor.

Bajamos hasta el ghat crematorio y nos acoplamos en unas escaleras para contemplar lo que allí pasaba.

Decir que este ghat tiene fama de haber mucha presión para conseguir dinero para la leña por parte de los familiares; pero en particular no lo vi peor que en otras zonas. Si que se te acercaban para decirte si querías subir al edificio para verlo, pero con un simple no gracias se iban y punto. Además había otros turistas y no vimos tampoco presión hacia ellos.

Desde donde estábamos se veía suficiente como para uno hacerse una idea. Había varias piras de leña ardiendo con el difunto. La verdad que no es apto para cualquiera porque, aunque estaban ardiendo, algunas partes de los difuntos se veían bastante bien.
Curioso también que todo esto estaba mezclado con las vacas y perros merodeando por los restos de cenizas, o simplemente tumbados entre los restos.

También veíamos a niños y adultos metidos en el río con una especie de red, que supongo que les servía para sacar las joyas y cosas que no se hayan quemado.

Estuvimos allí sentados como una hora y media y vimos llegar poco a poco a un montón de cadáveres tapados con el sudario naranja, acompañados por gente que iban recitando algo. Veíamos que lo sumergían en el río y luego lo sacaban y se quedaba a la espera para prenderse fuego. También veíamos que los familiares hacían cosas alrededor del cuerpo (aunque esto no llegamos a verlo bien y nos daba un poco de apuro acercarnos)

Recuerdo que con uno de estos cadáveres el ritual fue diferente, porque en vez de esperar para la incineración, lo que hacían era subirlo a una barca con unas cuantas personas y la veíamos alejarse sin más. Supongo que sería una de esas personas que no hace falta que se quemen y se tira el cuerpo directamente al río.

Eso sí, a pesar de todos los difuntos que allí había, no vi derramarse ni una lagrima, ni nada parecido. Al revés todo con mucha entereza y tranquilidad. 

Nos resultaba todo tan sorprendente, extraño, y… creó que no hay palabras para explicarlo.

A todo esto de vez en cuando se oían chasquidos y ruidos que procedían de las piras. Además había muchísima ceniza en el aire y por supuesto el olor, aunque no era del todo desagradable (lo bueno que no era verano) si que era algo peculiar.


Crematorio desde la lejania

Aquí pongo lo que sería el ritual de cremación.

“Morir en Varanasi es para todo hindú la bendición suprema. Si la muerte le sorprende en un perímetro de 60 Km. alrededor de la ciudad, Shiva, su divinidad tutelar, lo libera del ciclo perpetuo de las reencarnaciones y permite que su alma se funda para la eternidad en el paraíso, el Moksha. Muchos indios, al sentir su fin próximo, viajan hasta aquí para recibir a la muerte.
Esto constituye la razón por la cual no resulta extraño encontrar ancianos sentados a orillas del Ganges, esperando la muerte. No hace demasiado tiempo, se traía hasta aquí a los enfermos considerados incurables, para dejarlos morir en pequeñas chozas de rams, construidas en los ríos. ¡Ay de aquellos que sobrevivían! Considerado como un rechazo de los dioses a aceptarlos, este hecho conllevaba su inclusión en el grupo de los descastados. Este deseo de morir muy cerca del Ganges explica también la profusión de palacios más o menos lujosos, erigidos por los maharajás a lo largo del río.

Los encargados de las cremaciones son los doms, la más baja e impura de las castas. El jefe de los doms es alguien muy importante, decide lo que pagarán los familiares y sus órdenes se aceptan sin discusión. Se mantiene siempre cerca del símbolo de su poder y de su rango, un pequeño altar en forma de fuente donde arden las brasas del fuego que usa para prender las piras funerarias y del cual él es el supremo guardián. 

Cuando la gente muere en la religión hindú. Cuatro personas de la familia cargan con el cuerpo desde la casa hasta aquí, van cantando un mantra religioso que dice: rama nam sakta he, que significa: dios Rama nombre verdad.
Primero se sumerge el cuerpo en el río Ganges, esta es la última purificación del cuerpo, y todos los familiares le dan agua en la boca del cuerpo muerto tres veces cada uno.
Después de eso, un miembro de la familia se afeita el pelo, el bigote y la barba en el mismo ghat por un barbero, este hombre se da un baño en el río Ganges, luego la familia va a la oficina y hace el registro del cuerpo, vuelven a ver al dueño del Ghat de cremación, allí deben pagar por el lugar y por el fuego, cuyo fuego ha estado encendido desde hace mas de 3000 años sin parar, desde los tiempos en que la esposa de Shiva, Parvati, murió, hasta el día de hoy.
Luego los doms hacen una cama, el cuerpo es puesto por encima de la cama de troncos, por encima del cuerpo se pone más madera.
El pariente que se ha afeitado antes de comenzar el fuego, debe caminar 5 veces alrededor, porque el cuerpo esta compuesto por 5 elementos distintos, tienen que liberar estos elementos. Un dom le entrega una antorcha y empieza el fuego desde el lado de las piernas, las piernas siempre del lado del río, entonces una vez que se prende el fuego tarda un mínimo de 2 horas, máximo de 3 horas para quemar el cuerpo, aunque según que madera no se queman del todo. (Se necesitan unos 350 Kg de madera, para asegurar una cremación íntegra. La madera de más calidad (de sándalo) puede costar incluso más de 100 rps el Kg. La menos cara se paga alrededor de 5 rp, pero arde mucho peor (¡el cadáver no se quema por completo!). 
Así que el hombre que encendió el fuego debe levantar los restos del cuerpo con una caña de bambú y tirarlo al río Ganges.
Toda la familia debe bañarse en el río Ganges, para ser purificados, luego la familia vuelve a la casa, el hombre que prendió el fuego, no puede tocar a nadie durante 10 días. El ultimo día todos los hombres juntos se afeitan el pelo, los bigotes, la barba.
El brahman dice el mantra mientras la familia lo repite, hacen una comida especial, esta comida no es para la familia, es para 5 lugares diferentes: para vaca, perro, ave, Ganges, tierra.
Luego la familia vuelve a casa y hacen una gran fiesta para el sacerdote, la persona que murió, las cosas que uso durante su vida material, la familia no las usa, se las dan al sacerdote, luego el sacerdote da la bendición, y durante un año no puede haber en la familia ninguna ocasión especial, ningún casamiento, ninguna fiesta, picnic, ceremonia, veneración: un año de luto.

Pero hay algunos tipos de cuerpos no se queman:
- Sadhu el hombre santo, no se quema, porque sadhus ya están purificados, no necesitan ser purificados, se agarra una piedra pesada, se ata el cuerpo a ella y desde un bote se tira en el medio del río para que se hunda.
- El cuerpo de los niños no se quema, porque los chicos son inocentes, debajo de los 13 años.
- La gente con lepra no se queman porque la lepra es símbolo de la diosa madre, si se quema a los leprosos significa que estamos quemando a la madre, así que viviendo de la madre y volviendo a la madre Ganges para purificar la lepra, la próxima vida podría ser una buena vida.
- Las mujeres embarazadas no se queman porque llevan consigo un inocente. - Los animales no se queman, porque los animales son símbolos de dioses y diosas, estos también van al río.
- La gente mordida por una cobra, la cobra es el collar de Shiva, además la cobra es un veneno, si alguien es mordido por una cobra el cuerpo se llena de veneno pero no esta realmente muerto, solo perdió los sentidos a causa del veneno, así que la familia trata de buscar alguna persona espiritual que tenga energía cósmica, si la familia tiene mucha suerte y encuentran a esta persona espiritual, lo llaman, y por su poder espiritual le saca el veneno del cuerpo para que este vuelva a la vida con la familia, pero si la familia no tiene suerte y no pueden encontrar a esta persona espiritual en 24 horas, entonces la familia lleva el cuerpo al río, pero no pueden quemarlo, si lo queman por el humo la gente se envenenaría, si lo hunden en el río Ganges, este se llenaría de veneno para los peces, delfines, tortugas, y si lo entierran, todos se llenarían de bacterias.
Entonces toman 3 grandes árboles de banana para hacer una pequeña balsa, el cuerpo se pone sobre esta, en un papel de plástico se anota la dirección y el cuerpo simplemente va flotando por el río Ganges.
A veces hombres santos y espirituales, sadhus, ven al cuerpo, lo agarran gracias al poder de la energía cósmica, le sacan el veneno al cuerpo, si la persona muere todavía hay tres días para devolverle la vida, con la dirección anotada pueden mandarlo nuevamente a su casa. Si pasan 3 días después de muerto es imposible devolverle la vida, entonces solo se limpia el veneno, luego el cuerpo se hundirá en el río Ganges.

Hace mucho tiempo, cuando moría el hombre, se practicaba el sati en el cual la mujer del fallecido tenía que saltar a la pira de su difunto. Las autoridades británicas pusieron fin a esta brutal práctica en 1829, aunque el último sati conocido fue el 21 de agosto de 2006”


Texto sacado de: 
roxi1970.wordpress.com...%AA-parte/
www.losviajeros.com/Bl...hp?e=16285

Tras estos nos fuimos de nuevo a disfrutar del ambiente de lo Ghats. Íbamos de ghat en ghat observándolo todo: barqueros que te decían de dar una vuelta, vendedores de todo tipo, sadhus, gente bañándose, gente meditando… Vamos lo mismo que ayer. Es que nos gusto tanto que decidimos hacer lo mismo.

 
Barquero del Ganges. Niños bañándose



Vida social en los ghats

Tras un par de horas de paseo, decidimos tomarnos un refrigerio en lo alto de una de esas terrazas de guesthouse que hay en la orilla. 
Nos decidimos por el del restaurante Sita guesthouse en el rana ghat. Así que a subir esas tremendas escaleras que empieza a ser normal en todas las guesthouse de la zona, y cuando llegamos a la terraza…GGGGUUUUUAAAAAAUUUUUUUU que vistas tenía. 


Vistas desde el restaurante

Y allí con esas pedazo vistas tomamos un refresquito y, como olía tan bien la comida decidimos almorzar. Comimos Kostas malai (albóndigas), arroz con verduras, naan de queso y ajo, papas fritas, 2 lassis, 4 refrescos por 385rp. Esto si que era barato.


Me encanta la comida

Recomiendo totalmente este sitio, la comida riquísima y con unas vistas de infarto. Además el propietario es un encanto. Va sentándose de mesa en mesa para charlar. Por cierto nos dijo una cosa curiosa, con 30 millones de las antiguas pesetas con la que te compras una casa en España, en India te puedes comprar una guesthouse entera como el doble que la suya. También nos dijo que una de las cosas por las que el Ganges era sagrado en Varanasi porque justo al llegar a la ciudad su corriente cambia de curso. CURIOSO.


Nos quedamos allí un buen rato hablando y disfrutando de las vistas y la comida y, ya tocaba hora de ir a recoger las mochilas para ir a la estación.

Así que recogimos las mochilas y nos metimos de nuevo en el embrollo de callejuelas sorteando de nuevo todo tipo de obstáculos, que si moto, vaca, que no quiero comprar nada, no gracias pero no necesito guía, no puedo ir a tu tienda…

Por fin llegamos a la calle principal en donde había una treintena de rickshaws a la caza del turista. Primero nos decían 120rp, pero conseguimos regatear hasta 80rp (de todas formas me pareció caro, ya que la estación no estaba tan lejos).

El paseo en rickshaw a la estación por la ciudad de Varanasi fue todo un espectáculo, creó que había hasta más coches que en Delhi. Que pasada, pero ¡que manera de conducir! Yo cada 3 segundos pensaba “que nos damos, que nos damos, que nos damos”
La verdad que de todas las veces que monte en este tipo de vehículos, esta fue la más emocionante. No se ni cuantas veces pensé que íbamos a salir lanzados por algún golpe.
Llegamos a la estación y…. menos mal, no era tan caótica como la de Delhi, había gente pero no esa aglomeración abismal.

En seguida localizamos el tren en la pantalla de información. Ponía 2 andenes, así que fuimos a uno de ellos y preguntamos y nos dijeron que por ahora era ese. 
Así que como habíamos llegado con una hora y media de antelación (por si acaso, que aún no le teníamos el truco a las estaciones y además no estamos acostumbrados a coger trenes, ya que en Canarias no hay ni uno) nos acoplamos en el andén a observar.

Nos llamó la atención un carrito ambulante que vendía de todo e iba cerca de los trenes vendiendo incluso hasta por las ventanillas. También vimos la cantidad de gente que puede entrar en la clase normal. Que barbaridad, me sentí hasta mal porque me recordaba a esas escenas que se ven en películas sobre el holocausto judío cuando los transportaban en trenes. Era alucinante como podían entrar más y más gente. 

Y lo más llamativo… vimos algo sagrado en el andén que jamás me imaginaría que pudiera estar allí…

UNA VACA

“¿Pero que hará una vaca aquí?” Capaz que estaba esperando el tren jeje

 
Vendedor ambulante por los andenes. Si, Si, una vaca a la espera del tren jeje

Como teníamos la cámara de foto en mano había muchísima gente curiosilla para que le enseñaras la cámara. Primero se sentaban al lado tuyo y se ponían a mirar y claro, uno se la acababa enseñando y le dejábamos hacer fotos y todo eso, y ellos super contentos.

También nos pusimos a repartir entre algunos niños unos bolígrafos que al agitarlo se encendían con montón de colores. Me encantaba la cara de los niños, ya se alegraban cuando veían el bolígrafo, pero cuando se lo agitábamos, su sonrisa se volvía indescriptible. Flipaban hasta los padres.

Seguíamos esperando y como de la megafonía no nos enterábamos de nada, decidimos volver a preguntar si era ese nuestro andén, ya que faltaba solo media hora. Para nuestra sorpresa Chocado resulta que lo habían cambiado a la vía de al lado y allá que nos fuimos.

Había un tren en el andén y la numeración coincidía con el nuestro, por lo que supusimos que era ese. Ahora a ver en donde, tocaba buscar el nº de vagón.
Vimos unos papelitos con un listado y, por fin vimos nuestros nombres.
BIIIIEEENNNNN
Que alegría nos dio, después de la mala experiencia en Delhi, estábamos algo desconfiados.

Habíamos cogido 2AC. Cada compartimento estaba compuesto de 2 literas (4 camas), pero no era un compartimento cerrado, sino lo separaba del resto por una cortina. También te daban sabanas, mantas y almohada gratis. El tren no estaba mal del todo, aunque es mejor no compararlo con los trenes europeos.
Lo peor sin lugar a dudas el baño, aquí diré que hay de 2 tipos, los de agujeros y los de taza, pero parecía que no le habían pasado una manita de agua y jabón desde hace siglos.

 
Literas del compartimentos de 2 AC. Lavamanos moderno del tren

 
Los diferente tipos de baño. Huelen que alimenta. BUUUAAGGGG

Antes de partir el tren, vino la policía armadas con unas metralletas alucinantes y nos hicieron rellenar un papel con lo típico que también te hacen rellenar en todos los hoteles (datos personales, de donde vienes, a donde vas…) y otro papel en donde venía un montón de recomendaciones que debes de seguir?????
La verdad que esto solo nos paso en este tren, ya que en los demás que fuimos cogiendo no hicimos nada de eso.
Otra cosa curiosa es que había puesto un montón de paneles informativos por todo el vagón que decía que tocar a una mujer era pena de cárcel. 

Desde luego entre la policía y los paneles yo pensaba “¿pero dónde nos hemos metido?” Pero naaaaaa, sin problemas.

Y por fin, a las 18:05 sale nuestro tren. Y después de 2 horas circulando nos fuimos a dormir, no sin antes poner el despertador ya que llegábamos a las 03:34 de la mañana a Mahoba, y yo a esas horas sin despertador no me levanto.



Preparándome para echarme una cabezadita

LO MEJOR DEL DÍA: El paseo matinal por el Ganges.

LO PEOR DEL DÍA: Absolutamente nada

GASTOS: 
- Paseo por el Ganges(los dos): 300rp
- Desayuno Scindhia ghesthouse 2 personas: 245rp 
- Refrescos estación: 30 rp
- Agua estación: 15rp
- Restaurante Sita guesthouse 2 personas: 385rp
- Rickshaw desde el chowk a la estación: 80rp

CONCLUSIONES: Varanasi me sorprendió. No pensaba que me iba a gustar tanto como lo hizo. Se que la gente como norma habla muy bien, aunque me echaba para atrás la forma de hablar de la suciedad de las calles y de la presión de los vendedores. Pensaba realmente que lo iba a pasar mal. ¡QUE EQUIVOCADA ESTABA! no pensé que podía sorprenderme tanto. 
Se que nos hubiera dado tiempo perfectamente para ver templos y más sitios, pero desde mi punto de vista, aunque tengamos cosas planeadas, si estamos disfrutando de algo muchísimo, prefiero pasar de lo otro y seguir más tiempo con lo que me esta gustando. Y eso fue lo que hicimos: pasear y disfrutar de la gente. También diré que no me resulto tan agobiante en cuestión de vendedores e intentos de estafas como había leído, quizás tuvimos suerte. 
Sin duda aquí me equivoque, 2 días es poco para Benares, por lo menos pondría 4 días aquí; pero al menos me consuelo de que el poco tiempo que estuvimos lo disfrutamos al máximo. Desde luego que si vuelvo a India, pasaría otra vez por la ciudad.









5 comentarios:

  1. GGGuuuuaaaaauuuuu, como tu dices.
    Vaya pedazo de artículo y fotos excelentes.
    Me encanta, lástima que el post, esté un poco cortado por el lado derecho.
    Saludos

    ResponderEliminar
  2. Gracias gildo.
    No se a que te refieres con lo de cortado por el lado derecho, a mi se me ve bien. ¿No se te ve todo?
    De todas formas mientras averiguo lo que es puedes mirarlo en los diarios de India de Los Viajeros, que es el mismo.

    NAMASTE

    ResponderEliminar
  3. Ya lo he arreglado. lo que pasa es que yo uso el google crhome y con ese se ve perferco. pero con Internet explorer se cortaba, así que tuve que reducir las imágenes para que se me vean en ambos.
    Muchas gracias por decirmelo porque sino ni me entero.

    Saludos

    ResponderEliminar
  4. De nada Marta. Yo utilizo el Firefox.
    De todas formas, me he tomado la libertad de presentarlo (este post) en "Divoblogger", una especie de "Meneame", pero en menor medida. Es un lugar para promocionar webs/blogs.
    Por supuesto que, si encuentras algún defecto en mi blog (que seguro lo hay), también estaré encantado de que me lo digas.
    Me entusiasmé tanto con tu post, que me daba lástima no poder leerlo completo.
    Sigo diciendo que el artículo, las fotos y las explicaciones, son......superiores.
    Venga, un saludo

    ResponderEliminar
  5. Ok, gracias presentalo dende quieras. No entiendo mucho de lo de promocionar las webs jeje

    Creo que ya lo he arreglado, al menos se me ve con google y crome. Con firefox no lo se porque no lo tengo. Dale un vistazo y me dices.

    Tu blog lo veo genial, no he visto nada raro.

    Me alegro de que te guste el post, es que Varanasi me encanto pero sigo diciendo que es imposible explicar lo que ves alli. ES UNA PASADA
    Gracias por todo
    Chao

    ResponderEliminar

GRACIAS POR COMENTAR