“UN VIAJE ES COMO UN LIBRO, SE COMIENZA CON INQUIETUD Y SE TERMINA CON MELANCOLÍA”           "VIAJAR NO ES LLEGAR A UN LUGAR, ES ABRIR UN CAMINO"           "NO VIAJES PARA ESCAPAR DE LA VIDA. VIAJA PARA QUE LA VIDA NO SE TE ESCAPE"           “COMO TODOS LOS GRANDES VIAJEROS, HE VISTO MÁS DE LO QUE PUEDO RECORDAR, Y RECUERDO MÁS QUE LO QUE HE VISTO”


12 noviembre 2011

VISITANDO KHAJURAHO - LA CIUDAD DEL KAMASUTRA

VIERNES 25 NOVIEMBRE DEL 2011
Suena el despertador 20 minutos antes de la parada, menuda pereza a esas horas.
El tren para y nos pusimos a mirar el código de la estación para ver si era esa, pero… que vaaaaaaaaa.
Nos dicen que el tren va con retraso y que más o menos llegaríamos en 2 horas. (Dichosa niebla).
Un inciso, si vais en tren, sacaros las estaciones que hay antes de vuestra parada, así es más fácil saber por donde andas. Muchas estaciones ponen el código de la parada en carteles o rótulos, pero ojo, porque hay paradas que no pone na de na y tienes que ir preguntando.

Bueno, si íbamos a tardar 2 horas, pues a pasarla un ratillo durmiendo. Así que a tumbarnos y a poner el despertador otra vez. Pero claro, una vez que te has despertado, pues ya no hay manera, lo único que hacíamos era darnos pequeñas siestillas y despertándonos continuamente. Estábamos algo preocupados porque el tren de Mahoba a Khajuraho salía a las 05:20, y con 2 horas de retraso llegábamos justos, aunque lo bueno que como esta tan cerca, siempre se podría alquilar un coche, ó mirar un bus.

Pasan 2 horas y aún nada. Vamos preguntando y nos dicen que todavía no, que debe faltar ¾ de hora. Definitivamente íbamos a perder el tren.

Hubo una parada en la que se paro unos 20 minutos, y salimos un poco fuera para ver el ambiente de la estación. Era super tétrico, en medio de vete a saber donde, allí parados, en donde no se veía ni un occidental y todo el mundo mirando como diciendo “¿y estos de donde han salido?”


La parada en algún lugar vete a saber donde

Nos volvimos a tumbar los dos en la cama de abajo, y tras un rato, de repente viene el revisor (al cual solo vimos cuando salimos de Varanasi) para decirnos que la siguiente era nuestra parada. Si llego a saber que el revisor nos iba a despertar… no hubiéramos estado dando vueltas como hicimos y, lo más importante ¡HUBIERAMOS DORMIDO DEL TIRON! Tanto rollo para arriba y para abajo, mirando cartelitos para ver la estación, preguntando…para luego esto.

Tranquilamente salimos del tren, y fuimos a ver si por casualidad el tren no había pasado, aunque con pocas esperanzas ya que eran las 06:00. Y…¡BINGO! vimos el cartelito escrito a mano con retraso de 2 horas. (Gracias niebla je, je)
Así que a esperar en la estación.

La verdad que la vida de las estaciones son muy variopintas. Ves de todo: animales, porteadores con maletas en la cabeza, gente adinerada, mendigos, gente que parecía que se llevaba la casa a cuesta de todas las cosas que tenían…


Gente esperando en la estación

Algo curioso fue cuando por megafonía dicen algo, y en el andén de en frente para un tren; de repente un montón de gente de nuestro andén con todos los bártulos empiezan a saltar a las vías para subirse al tren.


Personas cruzando las vías para subir al tren

También había gente que se acercaba solo para hablar (sin intentar venderte nada), la verdad que son super curiosos, te preguntan de todo.

Por fin vino nuestro tren (al final fue un retraso de 3 horas). Habíamos pillado sleeper, ya que iba a ser un recorrido corto, y pensábamos que sleeper iba a ser malillo. Pero que vaaaa,nos toco uno bastante limpio. 
Además nos encontramos a varios indios que hablaban español e íbamos parloteando un rato.

Los vagones de sleeper esta dividido en compartimento de 2 literas de
3 alturas (6 camas), pero sin cortinas que los separen del pasillo, ni tampoco te dan mantas, sabanas… También tiene en frente de los compartimentos otra litera de dos camas que son las side upper (cama de arriba) y side lower (abajo) (esto lo tienen todas las clases en las que hemos viajado). Lo bueno de estas que, aunque esta en pasillo, para mi tienes más intimidad (en este caso no porque no hay cortinas, pero en 2 y 3 AC si la hay)

 
Uno de los chicos que hablaba español. Vista de los compartimentos con literas de 3 camas

Otro inciso: Hay un tren que va de Varanasi a Khajuraho directo pero solo hay 3 veces a la semana
- Khajuraho-Varanasi: Martes, Viernes y Domingo, Nº tren: 21107 Con salida a las 23:20 y llegada a las 10:50.
- Varanasi-Khajuraho: Lunes, Miércoles y Sábados, Nº tren:21108 Con salida a las 18:05 y llegada a las 05:00

Llegamos a Khajuraho y al salir de la estación había un montón de conductores por todos lados ofreciendo sus servicios como locos. Era una pasada de gente, una se sentía agobiadilla, pareces hasta un famoso sin escolta jeje.

De repente uno me empieza a hablar en perfecto español y encima con carrerilla, y como nos llama la atención decidimos ir con él hasta el centro por 40 rp.
Durante el trayecto acordamos que pasaríamos por su guesthouse, la mirábamos y si no nos gustaba pues nos íbamos a otra, y accedimos, ya que estaba cerca de las que habíamos pensado por la zona de los templos.
También intento vendernos un montón de excursiones y el trayecto a Orchaa, pero me pareció caro y preferí esperar para comparar otros precios.

Nos llevó al HOTEL CASA DI WILLIAM, una gusthouse cerca de los templos y a 5 minutos de la calle principal. Nos enseño varias habitaciones. Por supuesto al principio nos enseño la más cara con tv y AA, pero realmente ni la tv, ni el AA hacían falta. Así que nos enseñó tres más y optamos por lo más barata. Primeramente nos pedían 450 rp y al final, con pretensión de que nos íbamos a ver otras nos la dejo a 300rp.
La verdad que la habitación estaba genial para 4 euros y poco que costaba, grande, camas cómodas, ventilador el techo y el baño era el más decente que nos habíamos encontrado por ahora, por tener tenía hasta papel higiénico,GGGGGUUUUUUAAAAAAUUUUUU, fue la primera vez que nos daban este artilugio jeje. 

 
La habitación y la entrada al baño

 
El baño de lo mejorcito para ser India y... PAPEL HIGIÉNICO

Por ponerle alguna pega, diría que no limpiaban el polvo bien (si eres alérgico como yo, lo notas en seguida) pero eso sin problema. Con una toallita húmeda a limpiar el polvo jeje. Mr. Green 

Luego rellenamos todo el embrollo de papeles de registro (el de la guesthouse y el de la policía para tener a uno controlado) y a desayunar a la terraza que apretaba el hambre.

La terraza estaba genial y se divisaba algún templo que otro. También se veía la vida en la calle, que si tres en moto con un ¿jabalí? ó algo parecido al lado, que si una vaca, que si lavando la ropa en el río…

 
Vida en la calle. Fíjense a los tres en moto y al lado lo que creo que es una especie de jabalí.


Gente lavando ropa en el río y el niño lavándose los dientes.

Desayunamos con la pachorra nuestra de costumbre y a disfrutar de Khajuraho que ya se estaba haciendo tarde.

Khajurajo: “Pequeña localidad situada en el estado de Madhya Pradesh. El nombre de la ciudad proviene de la palabra Kajur que en idioma hindi significa "palmera datilera". Khajuraho fue la capital religiosa de los Chandella, una dinastía que gobernó esta parte de la India entre los siglos X y XII. Aquí se encuentra el mayor conjunto de templos hinduistas del país, famosos por sus esculturas eróticas. Los templos están considerados por la Unesco como Patrimonio de la Humanidad, desde el año 1986.”
Esta ciudad tiene los templos divididos en 3 zonas: 
- Los del grupo oeste, que son los más llamativos y están justo en donde estábamos, siendo la zona turística de la zona.
- Los del grupo este que están en el pueblo, esta cerquita, a unos 15 minutos andando desde la calle principal de la zona turística; pero están más desperdigados. Son gratis.
- Los del grupo Sur que están más lejos y se considera menos importante. Son gratis

De camino a los templos paramos en la oficina de turismo para que nos dieran un mapa. ¡PEDAZO MAPA! Aquello parecía un croquis hecho a mano jeje Riendo Riendo . También preguntamos opciones para ir a Orchaa y nos dijeron tres opciones:
- Tren a Jhansi y de allí pillar otro taxi o rickshaw a Orchaa, que salía a las 18:15 y llegaba a las 23:10, todos los días salvo los jueves. Éste descartado porque queríamos salir al día siguiente temprano.
- Bus local y creó recordar que eran 3 al día que iban directamente a Jhansi y otro que te dejaba en un cruce entre Jhansi y Orchaa. Recuerdo que salían temprano pero nos dijo que tardaba bastante y muchas veces no salen hasta que se llene el bus. Por lo tanto descartado. Nos hubiera gustado pillar un bus de estos locales para vivir la experiencia, pero si sólo íbamos a estar 1 día en Orchaa no nos queríamos arriesgar.
- Última opción y la que vimos más apropiada, conductor ó taxi directo a Orchaa.

Y por fin llegamos a la entrada de los templos. Aplauso Aplauso 
Todos los templos del grupo Oeste están cerca unos de otros cercados por una muralla. La entrada a los templos cuesta 250rp (con cámara ó sin ella). En la entrada vimos que había audioguías en español en un cartelito, pero fui a preguntar y nada de nada. El cartel estaría de decoración porque solo tenían en Ingles.
Al entrar hay que pasar por un control de metales que pite ó no pite da igual, no te dicen ni mu. También te registran el bolso, aunque a los turistas extranjeros solo te abrían el bolso y para dentro; sin embargo a los indios les sacaban todo del bolso mirando rigurosamente. (Creo que no puedes entrar con tabaco, mechero, cerillas, comida… ya que vi que eso era lo que le estaban sacando a la gente de los bolsos).

Por dentro era enorme, un bonito parque con césped en donde había desperdigados un montón de templos.

TEMPLOS DE KHAJURAJO: “Unos de los patrimonios de la humanidad. Son construcciones de granito que forman las paredes onduladas con salientes divididos en franjas horizontales mediante molduras y bajorelieves, y lo más especial son las esculturas que decoran muchos de ellos.
Estas figuras se pueden dividir en cinco tipologías, por un lado los techos están decorados con dibujos geométricos y florales, por otro se encuentran las escenas clásicas de la corte, con bailes o actividades cotidianas. Como tercer conjunto se encuentran las figuras animales como forma de romper la monotonía humana. El cuarto se trata de recreaciones de dioses que normalmente se encuentran en los puntos menos visibles, generalmente en su interior.
Y por último las recreación de escenas sexuales de lo más explicitas, sexo en parejas, orgías, posturas de todo tipo evocando al famoso libro indio del kamasutra, hasta llegando a verse actos de zoofilia
No está claro cual fue el motivo por el que los templos se decoraron con estos motivos eróticos. Algunos estudiosos sostienen que la decoración tenía un motivo educativo: enseñar el Kamasutra a los más jóvenes; para otros, los templos son un homenaje al matrimonio entre Shivá y Párvati. También existe la teoría de que las esculturas representando a amantes servían de protección, ya que ahuyentaban a los malos espíritus y a los rayos. Aunque parece ser que la idea más extendida es que representan una filosofía de vida en la que se intenta satisfacer los instintos (Kama: amor, placer, deseo y sexo) y de esa forma hacer un pacto con las divinidades para conseguir la iluminación (Sutra: tratado).”

Así que una vez dentro empezamos con la ruta erótica.
El primer templo que vimos es el templo de Parvati, un pequeño templo medio blanco, que estaba cerrado al público. Éste es un templo dedicado a Vishnu. No me pareció muy llamativo.


Templo de Parvati

Seguimos por la senda hacía la derecha y allí estaban los templos de Vishvanath y Nandi, los dos juntos uno en frente del otro en la misma plataforma.

El acceso a ambos templos era curioso, ya que 2 elefantes de piedra custodiaban las escaleras de acceso a la plataforma. 


La entrada a los dos templos vista desde la plataforma

Primero fuimos al templo de Nandi. Es un templo pequeño, no tan decorado exteriormente como otros que vimos, aunque había alguna otra escultura curiosa. 


El pequeño templo de Nandi

Dentro de este templo estaba la figura de un toro que se llama como el mismo templo (no se complicaron la vida), y es el toro que según la mitología monta Shiva.

 
Detalle del exterior. Nandi el toro que sirve de montura a Shiva


Mujer en el templo de Ninda

Ahora nos vamos en frente para ver el templo de Vishvanath y…UUUUUUYYYYYY UUUUUUYYYYYY que ya los templos suben de tono.

TEMPLO DE VISHVANATH



Entrada al templo de Vishvanath

Todo el exterior del templo tenía muchísimos detalles y esculturas curiosas. Se mezclaban esculturas de bailarinas (apsaras) con mujeres con instrumentos (surasundari) acompañado todo esto con las famosas escenas picantes del Kamasutra (mithuna). Vamos aquello parecía una orgía en toda regla. Había posturas que las mirabas y decíasIMPOSIBLE. 

 
Escenas eróticas. 


Panel lleno de esculturas donde se mezclan bailarinas, mujeres tocando instrumentos y escenas eróticas


Figuras de bailarinas

 
Más posturas eróticas

Entramos al interior y lo que llamaba la atención eran los techos. Todo estaba también decorado con esculturas de dioses, bailarinas y animales. También había un pequeño altar dentro de un cuarto pequeño con algo dentro que ni idea de lo que era. 

 
El cuarto con el altar. Los techos del interior del templo

Una cosa que nos llamo la atención y que pasaba en todos los templos era que las figuras que estaban al alcance de la mano tenían la zona de los pechos más desgastados que lo demás. Debe ser que tocarlas trae buena suerte jeje

Luego fuimos hacía una zona con 4 templos cerca.

Por un lado estaba el templo de Laksmi, pequeño, bonito y sencillo; sin cosas indecentes que enseñarnos.


Templo de Laksmi

Al lado de este estaba el templo de Varaha, parecido al anterior en donde dentro había un jabalí. Al parecer este animal es el dios Varaha, encarnación del dios Vishnu.


Jabalí que representa a Varaha

Justo en frente teníamos 2 templos. Uno de ellos es el templo de Matangesvara, en el que no se podía pasar por algún acto religioso que había en el templo. El templo llamaba la atención porque el color era de piedra oscura envejecida, y no habíamos visto ninguna así.


Templo de Matangesvara con feligreses

Justo al lado estaba el templo de Laksmana dedicado a Vishnu. Un templo de los más grandes que vimos, en donde estaba el templo en el centro y rodeándolo en las 4 esquinas había 4 pequeños templos. 


Entrada del templo de Laksmana con sus 4 pequeños templos en la esquinas

Si uno de los templos que habíamos vistos salía de tono, este ya se ponía al rojo vivo.

Había bailarinas contorneando las caderas, muchísimas esculturas eróticas, incluso esculturas de zoofolia con caballos y elefantes. 
Pero también había esculturas de flores, mujeres tocando música (supongo que ayudan a caldear el ambiente en plan romántico jeje Mr. Green ) y guerreros (pero claro esto después de tanta posturita llama menos la atención)
Todas estas esculturas eran de diferentes tamaños y están en todas las paredes del templo (y es bastante alto). Hay tantas esculturas que no sabes a donde mirar.


Bailarinas sexys y orgías

 
Más posturitas. Uno de los lados del templo lleno de esculturas en la parte de abajo y con dibujos geométricos en la parte de la cúspide


Esculturas de zoofilia con elefantes. Estas esculturas servían de base al templo

 
Más esculturas de bailarinas y diosas

En los pequeños templos de las 4 esquinas no se podía pasar y estaba decorado con dibujos geométrico (eran más decentes Riendo )

En el interior del templo principal había más de lo mismo, con el techo decorado, más esculturas, un cuarto pequeño tipo altar al que podías rodearlo y ver en el paseo más esculturas.

 
Esculturas del interior del templo. Fíjense en la 2ª foto que hay ciertas zonas que están más pulidas y con menos polvo ¿por qué sera... Mr. Green ?


Escenas con ¿león?

En este templo hay hombres que se ponen al lado tuyo para explicarte alguna cosita que otra, claro que luego te piden dinero.

Luego nos fuimos al conjunto de templos más grandes, son 3 templos juntos que están sobre la misma plataforma: Kandariya, Mahadeva y Devi Jagadamba.


Vistas desde la lejanía de los tres templos

La verdad que el paseo estaba siendo curioso, además no había mucha gente, ni mucho agobio.

Primero fuimos al Kandariya, al parecer es el templo más grande del complejo, dedicada a Shiva y con nada más y nada menos que 872 ESTATUAS. Menuda labor esculpir todo esto.


Templo de Kandariya

Aquí más de lo mismo, picantito, picantito en todas las paredes del templo; mezclado para echarle un poco de agua fría con figuras geométricas en algunas zonas de las diferentes cúpulas que tenían.

 
Más erotismo y para enfriar un poquito figuras geométricas en las cúpulas

Al entrar llamaba la atención el arco que había con una especie de saliente, nos dijo un hombre que era el símbolo de bienvenida y que lo impuro se quedaba fuera ó al menos eso le entendimos, porque entre que mi ingles es de pena y el de los indios tiene un sonido un tanto peculiar, vete a saber si no entendí mal (estos arcos estaban en todos los templos grandes).
En el interior era lo mismo que todos los templos grandes, aunque en este caso el la especie de altar había un lingamrepresentando simbólicamente a Shiva.

 
El arco de la entrada. El altar con el lingam

Luego nos fuimos a los otros dos de la misma plataforma.


De izq. a der. el templo de Mahadova y el templo de Jagadamba

El segundo y pequeñísimo es el templo de Mahadeva dedicado también a Shiva. Aquí lo que destacaba era la gran escultura de un león con una mujer.


Escultura de león del templo de Mahadeva

Luego fuimos al templo de Jagadamba dedicado a Kali (una transformación de las que tiene la diosa Parvati). En esta había menos esculturas eróticas (aunque aún tenía franjas con orgías y escenas subidas de tono) y más esculturas geométricas y de flores.

 
Esculturas geométricas y de flores del templo

Y por último fuimos a ver el templo de Chitragupta que se encontraba en obras, en donde por fuera no lo pudimos apreciar mucho, además de que ya estábamos cansados de tanta estatua, aunque la piedra era con colores diferentes al resto de los templos.


Templo de Chitragupta en restauración

Esta dedicado a Surya, el dios sol, cuya estatua esta en el altar del templo.


Interior del templo


El altar con Surya

Bueno, tras 2 horas y media de tanto paseíto y tanto picante, nos fuimos a picotear algo para que, con la comida hindú, se nos pusiera picante también la boca jeje

Pero antes de marcharnos y como en todo el recorrido, nos volvieron a pedir unas fotos para verse. 


Unos de las muchas personas que iban pidiendo fotos

La calle de los templos esta lleno de terrazas donde tomar algo; pero como nosotros queríamos también ver lo de ir a Orchaa, pues fuimos por la principal, la Jain temple. Esta calle es la típica calle turística llena de tiendas, guesthouse, restaurantes… 

Fuimos parando en un par de agencias de viaje y el precio no bajaba de 2500rp. Pero nos habían dicho unos españoles que nos encontramos en los templos que ellos desde Orchaa les habían costado 1500rp.
Casi al final de la calle entramos en Chandela tours y el hombre empezó por 2500rp, pero ante nuestra negativa hizo un par de llamadas para ver si tenía algún conductor que viniera de Orchaa con clientes y bajo a 1700rp. Fue su última oferta, ya que nosotros le dijimos que seguiríamos mirando, y que volveríamos por la noche en caso de que quisiéramos. 

Tras esto nos fuimos a picotear algo a una especie de restaurante familiar, que la entrada era como un garaje y que veías a la mujer como preparaba la comida en un cuarto aparte con las típicas hornillas de gas pequeñas. Fue un espectáculo. Por supuesto, el hombre super atento nos lavo las manos antes de comer con una garrafa de agua. ALUCINANTE.Pedimos un par de lassis, y 2 refresco (que iban a comprarlo en la tienda de en frente) ya que no teníamos mucha hambre, y con los lassis nos llenamos.

Después nos fuimos andando al pueblo para acercarnos a los templos del este.

Los templos de Este son 6: 3 hinduistas que están en el pueblo y 3 jainistas que están en las afueras.

Durante el camino se iban acercando varios niños de no más de 7 ú 8 años para intentar hacerte de guía, se ponían a hablar unas palabras en ingles, otras en español y al final te decían “Money”. “NOOOOOO, que no Money, pero toma un bolígrafo con luz”, y se iban tan contentos.
La villa es pequeñísima y allí cuando llegas todo el mundo te saluda desde las puertas de sus casas. Todo el rato “namaste, namaste, namaste”
De repente vimos algo que nos llamo la atención…una mujer sacando agua de un pozo tapado con la típica palanca. Que curioso, creó que no recuerdo haber visto uno en mi vida.


Aquí estoy intentando descubrir como funciona el artilugio del pozo

Por fin llegamos al templo hinduista de Brahma. Pequeñito, pero curioso ya que en cada bloque había unos números que, a pesar de que nos lo intentaron explicar dos personas que había por allí, no entendimos ni papa.


Templo de Brahma

No se puede entrar, pero por el lado del pantano hay una especie de ventana abierta, y dentro se ve un lingam con 4 caras. Al parecer aunque el templo tenga el lingam que simboliza a Shiva, realmente esta dedicado a Vishnu, estando representado en la entrada principal del templo.


El lingam con las 4 caras

Ahora seguimos caminando por el campo, y seguíamos viendo casas con gente haciendo vida social fuera. Esto me encanta, me recuerda a algunos pueblos de Andalucía en donde la gente se sienta fuera a hablar con sus vecinos.


Vida social en la calle

Vimos otro pozo de agua, aunque esta vez, era el que conozco de toda la vida, con su cubito, la cuerda y todo eso.


El pozo de agua de toda la vida

Llegamos al templo de Vamana y…la estampa por fuera era preciosa.


Templo de Vamana

Este templo esta dedicado a Vishnu y destaca un montón de grandes elefantes en los muros del templo. Por supuesto combinado con alguna que otra escena erótica. 




Esculturas de animales

También hay esculturas que son mitad humanas, mitad animales.


Estatua mitad humano, mitad vaca

El interior es como todos los demás templos, con esculturas y la habitación en donde esta el altar, y en donde esta vez había una imagen que… me lo dijo un hombre allí pero no me acuerdo.

 
El altar con una estatua. Detalle de uno de los marcos de acceso a la habitación donde esta el altar

Tras esto, decidimos que ya estábamos saturados de templos por hoy, así que nos fuimos hacia la guesthouse para bañarnos e ir a cenar.

El camino es precioso, lleno de colorido y con las montañas al fondo.

 
Paisaje de la zona

Llegamos al centro del pueblo y un montón de niños vinieron a pedirnos dinero, y nosotros “no, no, nooo”. Entonces nos dice que nos enseñan la escuela. Yo les digo que si es gratis, y me dicen, “no, Money, Money” pero que listos son jeje, auténticos buscavidas. Por supuesto rechazamos la oferta (lo siento pero a los niños no les doy dinero, además estos estaban muy bien comparados con los que vi a lo largo del viaje).

VIDA EN EL PUEBLO




Llegamos a la calle principal y vimos otra agencia y preguntamos el precio, el tío directamente nos dice que va a llamar al conductor y que si esta de vuelta de Orchaa no los deja a 1500rp. Nosotros flipamos, sin regateo y sin nada nos dice ese precio. Pero mala suerte porque al final no pudo ser.

Estuvimos mirando un par de tiendas de souvenir donde por supuesto cayó algún imán de nevera jeje, soy autentica aficionada a estos imanes. Mi nevera esta tan llena que a veces cuando la miro pienso “un día se me cae encima”

Compramos unas galletas y algún refresco y... ¡ADIVINEN LO QUE VIMOS!...


Recuerdo español con sabor a tomate

Luego nos fuimos a ver el atardecer al lago Shiv Sagar. 
El atardecer precioso, y para mejorarlo comienzan unas fuentes a echar agua combinado con luces de colores. Final perfecto.


Atardecer en Shiv Sagar


Shiv Sagar con las fuentes de colores

Estuvimos un rato allí y un hombre se puso a hablar con nosotros de su vida,. Nos dijo donde era su casa, que cuando quisiéramos estábamos invitados y un montón de cosas más. Un hombre encantador.

Hora de ducharse e ir al teatro Kandariya para ver el espectáculo de bailes típicos que empezaba a las 20:30. Pero antes nos pasamos por la agencia para cerrar el trato de lo de Orchaa por 1700rp.


Llegamos y estaba el dueño con un par de amigos. De repente uno de ellos dijo… “españoles, bonita tierra” y un montón de cosas más hablando el español perfecto. Total que al final el tío nos saca unas sillas y allí hablando durante 1 hora y media. Y a nosotros con lo poco que nos gusta hablar pues… adiós a los bailes típicos.

Hablaba tan bien porque estuvo estudiando en Barcelona, pero de verdad, no como muchos que te dicen eso y luego no tienen ni idea de nada. Nos estuvo hablando del tema de castas diciéndonos que en los pueblos si se solía cumplir aunque él decía que había abierto los ojos y era más liberal gracias a que ha estado mucho por Europa. Al parecer pertenece a la casta de los brahmanes, que es la superior de todas.
También nos dijo que quería montar una empresa para hacer de guía de habla hispana, pero que se notaba la crisis en España porque ya no venían tanto como antes (vamos el tío estaba enterado de todo).
Al parecer suele trabajar de vez en cuando para CATAI y otras empresas de España de guía. Y que de vez en cuando hacia trabajo por libre. Así que vuelvo a dejar su e-mail por si os interesa: prastudy@gmail.com Se llama Rajesh Awasthi, y es un tío que nos cayo genial. En ningún momento intento vendernos nada, era simplemente hablar.

Se nos hizo las 21:30 de la noche y decidimos irnos porque queríamos ir a cenar. Menos mal que nos gusta más comer que hablar porque sino, nos hubiéramos quedado allí toda la noche jeje. Mr. Green 

Nos fuimos al restaurante Mediterráneo, en la misma calle principal y… que bueno estaba todo. Es un italiano pero de los buenos de verdad. Comimos una pizza de atún (es la única vez que encontré un plato con atún en todo el viaje), fettuccini a la carbonara con champiñones, naan de ajo, 3 refrescos y dos pedazo postres que estaban de vicio: una crepe de plátano y miel, y el postre francés que estaba para chuparse los dedos. 
Además mientras comíamos desde la terraza se veía que en la calle estaban celebrando una de esas bodas que duran tantos días, con tambores, bailes y todo eso.

Eso si la cuenta fue algo carilla para India, pero fue el mejor italiano en el que comí en India. Total: sablazo de 1050 rp (aunque ahora pensando para todo lo que comimos 15 euros no es mucho jeje)

Tras esto a la camita a dormir que mañana teníamos que madrugar.


LO MEJOR DEL DÍA: Los templos del oeste y la charla con algunos del pueblo.

LO PEOR DEL DÍA: Lo pesado que son pidiéndote dinero, incluido los niños.

GASTOS:
- Coche estación tren-Khajuraho (los dos): 40rp
- Hotel casa di william 2 personas: 300rp
- Desayuno en el hotel (los dos): 200rp
- Agua: 15rp
- Refresco: 15-30rp
- Entradas al templo del grupo oeste: 250rp por persona
- Almuerzo picoteo (los dos): 120rp
- Imán: 65 rp (caro)
- Restaurante Mediterráneo (los dos): 1050rp

CONCLUSIONES: En un día realmente da tiempo a ver todos los templos, lo que pasa es que nosotros somos algo lentillos y nos entretenemos hasta con las hormigas Mr. Green . 
La ciudad es muy tranquila y puede servir para darte un relax si uno viene de ruta por las ciudades grandes.
Las esculturas eróticas son muy simpáticas, pero es algo que me sorprende porque estando en el aeropuerto ojeando un puesto de revistas, vimos que, aunque vendían revistas con las portadas subidas de tono, estas portadas estaban tapadas por otra hoja negra para no estar a la vista. En definitiva que son algo conservadores en este aspecto, y tener las esculturas a la vista me sorprendió. Pero claro, al ser tan antiguas y dedicada a los dioses, pues no habrá problemas.
Ojo con los niños si os dicen de ir a visitar su colegio, que luego piden dinero.












2 comentarios:

  1. Estupendo, por lo que se ve hay muchos indios que hablan español.
    Lo de menos polvo y más pulidas las protuberancias de la estatua femenina.....jejeje, muy bueno.
    Como me encanta el colorido de Asia. Además,veo que lo pasasteis muy bien.
    Buen artículo y fotos......excelentes y muchas

    ResponderEliminar
  2. Gracias Gildo.
    Fue raro pero donde más vimos indios que hablaban español fue en los pueblos.

    En general, lo pasamos bien, aunqueeeeeeeee ya iré contando jeje.

    Un saludo

    ResponderEliminar

GRACIAS POR COMENTAR